6GML image
Deposition Date 2018-05-27
Release Date 2018-09-05
Last Version Date 2024-05-15
Entry Detail
PDB ID:
6GML
Keywords:
Title:
Structure of paused transcription complex Pol II-DSIF-NELF
Biological Source:
Source Organism(s):
Method Details:
Experimental Method:
Resolution:
3.20 Å
Aggregation State:
PARTICLE
Reconstruction Method:
SINGLE PARTICLE
Macromolecular Entities
Polymer Type:polypeptide(L)
Molecule:DNA-directed RNA polymerase s
Chain IDs:A
Chain Length:1970
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:DNA-directed RNA polymerase s
Gene (Uniprot):POLR2B
Chain IDs:B
Chain Length:1174
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:RNA polymerase II subunit C
Gene (Uniprot):POLR2C
Chain IDs:C
Chain Length:271
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:RNA polymerase II subunit D
Gene (Uniprot):POLR2D
Chain IDs:T (auth: D)
Chain Length:142
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:RNA polymerase II subunit E
Gene (Uniprot):POLR2E
Chain IDs:D (auth: E)
Chain Length:210
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:RNA polymerase II subunit F
Chain IDs:E (auth: F)
Chain Length:127
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:RNA polymerase II subunit G
Chain IDs:U (auth: G)
Chain Length:172
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:DNA-directed RNA polymerases
Gene (Uniprot):POLR2H
Chain IDs:F (auth: H)
Chain Length:150
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:DNA-directed RNA polymerase I
Gene (Uniprot):POLR2I
Chain IDs:G (auth: I)
Chain Length:125
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:Uncharacterized protein
Chain IDs:H (auth: J)
Chain Length:67
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:Uncharacterized protein
Gene (Uniprot):POLR2J
Chain IDs:I (auth: K)
Chain Length:117
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polypeptide(L)
Molecule:Uncharacterized protein
Chain IDs:J (auth: L)
Chain Length:58
Number of Molecules:1
Biological Source:Sus scrofa
Polymer Type:polydeoxyribonucleotide
Molecule:Non-template DNA
Mutagens:bases 1-23 mutated, original sequence: CTCTGGCTATCTAGGGAACCCTC
Chain IDs:K (auth: N)
Chain Length:48
Number of Molecules:1
Biological Source:Human immunodeficiency virus 1
Polymer Type:polyribonucleotide
Molecule:TAR RNA
Chain IDs:L (auth: P)
Chain Length:46
Number of Molecules:1
Biological Source:Human immunodeficiency virus 1
Polymer Type:polydeoxyribonucleotide
Molecule:Template DNA
Mutagens:Bases 35-48 were mutated from ATAGATAGCCAGAG to AGGTACTAGTGTAC
Chain IDs:M (auth: T)
Chain Length:48
Number of Molecules:1
Biological Source:Human immunodeficiency virus 1
Polymer Type:polypeptide(L)
Molecule:Negative elongation factor A
Gene (Uniprot):NELFA
Chain IDs:N (auth: U)
Chain Length:528
Number of Molecules:1
Biological Source:Homo sapiens
Polymer Type:polypeptide(L)
Molecule:Negative elongation factor B,
Gene (Uniprot):NELFB
Chain IDs:O (auth: V)
Chain Length:577
Number of Molecules:1
Biological Source:Homo sapiens
Polymer Type:polypeptide(L)
Molecule:Negative elongation factor C/
Gene (Uniprot):NELFCD
Chain IDs:P (auth: W)
Chain Length:584
Number of Molecules:1
Biological Source:Homo sapiens
Polymer Type:polypeptide(L)
Molecule:Negative elongation factor E,
Gene (Uniprot):NELFE
Chain IDs:Q (auth: X)
Chain Length:404
Number of Molecules:1
Biological Source:Homo sapiens
Polymer Type:polypeptide(L)
Molecule:Transcription elongation fact
Gene (Uniprot):SUPT4H1
Chain IDs:R (auth: Y)
Chain Length:121
Number of Molecules:1
Biological Source:Homo sapiens
Polymer Type:polypeptide(L)
Molecule:Transcription elongation fact
Gene (Uniprot):SUPT5H
Chain IDs:S (auth: Z)
Chain Length:1087
Number of Molecules:1
Biological Source:Homo sapiens
Primary Citation
Structure of paused transcription complex Pol II-DSIF-NELF.
Nature 560 601 606 (2018)
PMID: 30135580 DOI: 10.1038/s41586-018-0442-2

Abstact

Metazoan gene regulation often involves the pausing of RNA polymerase II (Pol II) in the promoter-proximal region. Paused Pol II is stabilized by the protein complexes DRB sensitivity-inducing factor (DSIF) and negative elongation factor (NELF). Here we report the cryo-electron microscopy structure of a paused transcription elongation complex containing Sus scrofa Pol II and Homo sapiens DSIF and NELF at 3.2 Å resolution. The structure reveals a tilted DNA-RNA hybrid that impairs binding of the nucleoside triphosphate substrate. NELF binds the polymerase funnel, bridges two mobile polymerase modules, and contacts the trigger loop, thereby restraining Pol II mobility that is required for pause release. NELF prevents binding of the anti-pausing transcription elongation factor IIS (TFIIS). Additionally, NELF possesses two flexible 'tentacles' that can contact DSIF and exiting RNA. These results define the paused state of Pol II and provide the molecular basis for understanding the function of NELF during promoter-proximal gene regulation.

Legend

Protein

Chemical

Disease

Primary Citation of related structures
Feedback Form
Name
Email
Institute
Feedback