1QWA image
Deposition Date 2003-09-01
Release Date 2003-11-25
Last Version Date 2024-05-01
Entry Detail
PDB ID:
1QWA
Keywords:
Title:
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Biological Source:
Source Organism(s):
Mus musculus (Taxon ID: 10090)
Method Details:
Experimental Method:
Conformers Calculated:
17
Conformers Submitted:
17
Selection Criteria:
all calculated structures submitted,back calculated data agree with experimental NOESY spectrum,structures with acceptable covalent geometry,structures with the least restraint violations,structures with the lowest energy
Macromolecular Entities
Polymer Type:polyribonucleotide
Molecule:18S ribosomal RNA, 5'ETS
Chain IDs:A
Chain Length:0
Number of Molecules:1
Biological Source:Mus musculus
Ligand Molecules
Primary Citation
Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res. 31 6461 6472 (2003)
PMID: 14602904 DOI: 10.1093/nar/gkg866

Abstact

Nucleolin, a multi-domain protein involved in ribosome biogenesis, has been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of a hairpin loop structure (nucleolin recognition element; NRE). Previous studies have shown that the first two RNA-binding domains in nucleolin (RBD12) are responsible for the interaction with the in vitro selected NRE (sNRE). We have previously reported the structures of nucleolin RBD12, sNRE and nucleolin RBD12-sNRE complex. A comparison of free and bound sNRE shows that the NRE loop becomes structured upon binding. From this observation, we hypothesized that the disordered hairpin loop of sNRE facilitates conformational rearrangements when the protein binds. Here, we show that nucleolin RBD12 is also sufficient for sequence- specific binding of two NRE sequences found in pre-rRNA, b1NRE and b2NRE. Structural investigations of the free NREs using NMR spectroscopy show that the b1NRE loop is conformationally heterogeneous, while the b2NRE loop is structured. The b2NRE forms a hairpin capped by a YNMG-like tetraloop. Comparison of the chemical shifts of sNRE and b2NRE in complex with nucleolin RBD12 suggests that the NRE consensus nucleotides adopt a similar conformation. These results show that a disordered NRE consensus sequence is not a prerequisite for nucleolin RBD12 binding.

Legend

Protein

Chemical

Disease

Primary Citation of related structures
Feedback Form
Name
Email
Institute
Feedback